Friday, 15 December 2017
 
  Home arrow Core Markers
template designed by Joomla-templates.com
 
Main Menu
Home
ADME Gene List
Related Gene List
Core Markers
Search
Contact Us
Administrator
Advertisement
Core Marker List Print E-mail

This is a list of the markers that we determined to be most important. Note that not all of these markers have been reported previously in dbSNP.

 

Core Marker List

Gene
Star Nomenclature Nucloetide Change Amino Acid Change RS # Build Chromosome Position Upstream Sequence Downstream Sequence
ABCB1
  2677T>G,A   rs2032582 36 7 86998554 TTTACTCTACTTAATTAATCAATCATATTTAGTTTGACTCACCTTCCCAG ACCTTCTAGTTCTTTCTTATCTTTCAGTGCTTGTCCAGACAACATTTTCA
ABCB1
  3435C>T   rs1045642 36 7 86976581 AGAACATTGCCTATGGAGACAACAGCCGGGTGGTGTCACAGGAAGAGAT  GTGAGGGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACTGCC
ABCB1
  T1236T>C   rs1128503 36 7 87017537 CTGTTTCCAACCAGGGCCACCGTCTGCCCACTCTGCACCTTCAGGTTCAG CCCTTCAAGATCTACCAGGACGAGTGAGAAAAAAACTTCAAGGCAATTCA
ABCB1
  -129T>C   rs3213619 36 7 87068129 TAAAGGAAACGAACAGCGGCCTCTGCTTCTTTGAGCTTGGAAGAGCCGCT CTCGAATGAGCTCAGGCTTCCTGTGGCAAAGAGAGCGAAGCGGCTGTGCT
ABCC2
    V417I rs2273697 36 10 101553805 CTTATCTTTAGGCATTGACCCTATCCAACTTGGCCAGGAAGGAGTACACC TTGGAGAAACAGTGAACCTGATGTCTGTGGATGCCCAGAAGCTCATGGAT
ABCC2
    I1324I rs3740066 36 10 101594197 CGGTACCGACCTGAGCTGGATCTGGTCCTCAGAGGGATCACTTGTGACAT GGTAGCATGGAGAAGGTAGGTGGAGTGAAGGAAGGCCTGGATGGGAGGCC
ABCC2
  -24C>T   rs717620 36 10 101532568 ATGAAACAAGTAAAGAAGAAACAACACAATCATATTAATAGAAGAGTCTT GTTCCAGACGCAGTCCAGGAATCATGCTGGAGAAGTTCTGCAACTCTACT
ABCC2
    R768W rs56199535 36 10 101568567 TGAATTATTTTCTTCTTCAGGGTATAAATCTTAGTGGGGGTCAGAAGCAG GGATCAGCCTGGCCAGAGCTACCTACCAAAATTTAGACATCTATCTTCTA
ABCC2
    S789F rs56220353 36 10 101568631 CAGAGCTACCTACCAAAATTTAGACATCTATCTTCTAGATGACCCCCTGT TGCAGTGGATGCTCATGTAGGAAAACATATTTTTAATAAGGTCTTGGGCC
ABCC2
    A1450T rs56296335 36 10 101600383 CTTCTATTGGCTGCAGCATAGGCCAGAGGCAGCTGCTGTGCCTGGGCAGG CTCTGCTTCGGAAATCCAAGATCCTGGTCCTGGATGAGGCCACTGCTGCG
ABCG2
  421C>A   rs2231142 36 4 89271347 TTTTTCATGATTCGTCATAGTTGTTGCAAGCCGAAGAGCTGCTGAGAACT TAAGTTTTCTCTCACCGTCAGAGTGCCCATCACAACATCATCCTTAAGGC
ABCG2
    Q126X   36 4 89271981 CCATATAGAAACAGAGGAAACAGAAAATGCAAACCCACTAATACTTACTT TACCACGTAACCTGAATTACATTTGAAATTGGCAGGTCGCGGTGCTCCAT
CYP1A1
*2A     rs1048943 36 15 72800038 CACCCGTTGCAGCAGGATAGCCAGGAAGAGAAAGACCTCCCAGCGGGCAA GGTCTCACCGATACACTTCCGCTTGCCCATGCCAAAGATAATCACCTTCT
CYP1A1
*4 2453C>A   rs1799814 36 15 72800040 CCCGTTGCAGCAGGATAGCCAGGAAGAGAAAGACCTCCCAGCGGGCAATG TCTCACCGATACACTTCCGCTTGCCCATGCCAAAGATAATCACCTTCTCA
CYP1A1
*3 3205T>C   rs1800031 36 15 72799288 GACACAAGTCCCCAGCCCCTCCAGGACAGCAATAAGGGTCTTACAAGGCC GAAGGCAGCCCTGTTTGTTCCTGCCTGCAGGAAGGGCAGAGGAATGTGAT
CYP1A1
*6 1636G>T   rs56313657 36 15 72800857 CCTAGCTCCTCTTGGATCTTTCTCTGTACCCTGGGGTTCATCACCAAATA ATGAGGCTCCAGGAGATAGCAGTTGTGACTGTGTCAAACCCTGGACAGGG
CYP1A1
*5 2461C>A     36 15 72800044 TTGCAGCAGGATAGCCAGGAAGAGAAAGACCTCCCAGCGGGCAATGGTCT ACCGATACACTTCCGCTTGCCCATGCCAAAGATAATCACCTTCTCACTTA
CYP1A1
*8 2414T>A     36 15 72800079 AGCGGGCAATGGTCTCACCGATACACTTCCGCTTGCCCATGCCAAAGATA TCACCTTCTCACTTAACACCTTGTCGATAGCACCATCAGGGGTGAGAAAC
CYP1A1
*7 2346_2347insT     36 15 72800148 CCTTGTCGATAGCACCATCAGGGGTGAGAAACCGTTCAGGTAGGAACTCA ATGGGTTGACCCATAGCTTCCTGTAACCAGAGGGAGACAGCTGAAGTGGC
CYP1A2
*1K -729C>T   rs12720461 36 15 72828404 TGGGGACAGAAAGACGGGGAGCCTGGGCTAGGTGTAGGGGTCCTGAGTTC GGGCTTTGCTACCCAGCTCTTGACTTCTGTTTCCCGATTTTAAATGAGCA
CYP1A2
*1C     rs2069514 36 15 72825273 AGGCTGGAGTGCAGTGGTGCGATCTTGGCTCACCGCAACCTCCGCCTCTC GATTCAAGCAATTGTCATGCCCCAGCTTCCCGAGTAGCTGGAATTACAGG
CYP1A2
*1F -163C>A   rs762551 36 15 72828970 CCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGGGTGAGCTCTGTGGGC CAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAGCTGGGAGC
CYP1A2
*7 3534G>A   rs56107638 36 15 72832665 CCCAAGAAATGCTGTGTCTTCGTAAACCAGTGGCAGGTCAACCATGACCC TGAGTACATACCCCTCACGAAAAAATGTGTGCAGGTTCAGCAGTCAGGAA
CYP2A6
*2     rs1801272 36 19 46046373 CTTCTCCTGCCCCCGCACTCGGGGTCCCCTGCTCACCGCCAGTGCCCCGG GGGCGTCGATGAGGAAGCCCGCCTCCTCCTGGATGCGCTCCTCGATGCCT
CYP2A6
*9  -48T>G   rs28399433 36 19 46048219 CATGGTGGTAGTGGGATGATAGATGGTGACGGCTGGGGTGGTTTGCCTTT TACTGCCTGAAAAAGAGGGATGGACTTTGGCTGATTACATAATTACCTCA
CYP2A6
*17     rs28399454 36 19 46043107 CCGAAACTTGGTGTCCTTTTTGACTCTGCGGGCCAAACTCATGGGGATCA GTCTCCAAATCTTTGGATCTCGTGGATCACTGCCTCCATGTAGGGCATCT
CYP2A6
*8 6600G>T   rs28399468 36 19 46041572 GCACCGGCACAGCCCTCGCTCAGCGGGGCAGGAAGCTCATGGTGTAGTTT GTGGGATCGTGGCAAAGCCCACGTGTTTGGGGGACACGTCAATGTCCTTA
CYP2A6
*6     rs4986891 36 19 46046469 TGCCTCGCTTGCCCACCCCGAAGTCCCGCAGGGTGGCGATGGAGAAGCGC GGAGCTGCTTGGCGCGCTCCCCGTTGCTGAATACCACGCCTGGGGAGGTG
CYP2A6
*7 6558T>C   rs5031016 36 19 46041614 TGTAGTTTCGTGGGATCGTGGCAAAGCCCACGTGTTTGGGGGACACGTCA TGTCCTTAGGTGACTGGGAGGACTTGAGGCGGAAGTTCTGCATGACGGTG
CYP2A6
*5 6582G>T   rs5031017 36 19 46041590 CTCAGCGGGGCAGGAAGCTCATGGTGTAGTTTCGTGGGATCGTGGCAAAG CCACGTGTTTGGGGGACACGTCAATGTCCTTAGGTGACTGGGAGGACTTG
CYP2A6
*11 3391T>C   rs28399447 36 19 46044781 CAACTGAAAGGCCTGTTGCTGTGGTCCTGGCAGGTGTTTCATCACCGAAG GAACATCTCATAGAGCTGGGGTTGCAGAGAGAGGATGGGAAGGGAAGGAC
CYP2A6
*20 2141_2142delAA   rs28399444 36 19 46046280 ctttggggaccgctttgactataaggaca gagttcctgTCACTGTTGC
CYP2A6
*12   exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin   36 19      
CYP2A6
*1X2a   Breakpoint at intron 8 - 3'-UTR   36 19      
CYP2A6
*1X2b   Breakpoint at 5.2 - 5.6 kb downstream from stop codon   36 19      
CYP2A6
*4 gene deletion     36 19      
CYP2B6
*16     rs28399499 36 19 46210061 AATGAGATTCATTGGTCTTCTTTTCTGTACAGAGAGAGTCTACAGGGAGA TGAACAGGTGATTGGCCCACATCGCCCTCCAGAGCTTCATGACCGAGCCA
CYP2B6
*28     rs34097093 36 19 46210210 ACCTTCTCCCCATGGGTGTGCCCCACATTGTCACCCAACACACCAGCTTC GAGGGTACATCATCCCCAAGGTAAGACCGGCTGGAACCCCATAGCCCTCC
CYP2B6
*6 15631G>T   rs3745274 36 19 46204681 ACCTGCTGCTTCTTCCTAGGGGCCCTCATGGACCCCACCTTCCTCTTCCA TCCATTACCGCCAACATCATCTGCTCCATCGTCTTTGGAAAACGATTCCA
CYP2B6
*2 64C>T   rs8192709 36 19 46189114 TCCTCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTACTCCTGGTTCAG GCCACCCTAACACCCATGACCGCCTCCCACCAGGGCCCCGCCCTCTGCCC
CYP2B6
*8 13072A>G   rs12721655 36 19 46202122 AGGTGCTTCGGCGATTCTCTGTGACCACTATGAGGGACTTCGGGATGGGA AGCGGAGTGTGGAGGAGCGGATTCAGGAGGAGGCTCAGTGTCTGATAGAG
CYP2B6
*4     rs2279343 36 19 46207103 TGGCCACAGTGTGGAGAAGCACCGTGAAACCCTGGACCCCAGCGCCCCCA GGACCTCATCGACACCTACCTGCTCCACATGGAAAAAGTGGGGTCTGGGA
CYP2C19
*17 -806C>T   rs12248560          
CYP2C19
*4     rs28399504 36 10 96512453 AAGCTTGGAGTGCAAGCTCACGGTTGTCTTAACAAGAGGAGAAGGCTTCA TGGATCCTTTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTT
CYP2C19
*17(3SNPhap)     rs3758581 36 10 96592613 TTCTTACTTGTGTCTTGTCAGCTAAAGTCCAGGAAGAGATTGAACGTGTC TTGGCAGAAACCGGAGCCCCTGCATGCAGGACAGGGGCCACATGCCCTAC
CYP2C19
*8     rs41291556 36 10 96525163 TAGTTTCGTTTCTCTTCCTGTTAGGAATCGTTTTCAGCAATGGAAAGAGA GGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATG
CYP2C19
*2 80161A>G   rs4244285 36 10 96531606 GTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCC GGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATAT
CYP2C19
*3 17948G>A   rs4986893 36 10 96530400 AACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTG ATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTT
CYP2C19
*5 90033C>T   rs56337013 36 10 96602485 AGTTACACATGAGGAGTAACTTCTCCCTATGTTTGTTATTTTCAGGAAAA GGATTTGTGTGGGAGAGGGCCTGGCCCGCATGGAGCTGTTTTTATTCCTG
CYP2C19
*12 90209A>C   rs55640102 36 10 96602661 GGATTTGCTTCTGTCCCGCCCTTCTATCAGCTGTGCTTCATTCCTGTCTG AGAAGCACAGATGGTCTGGCTGCTCCTGTGCTGTCCCTGCAGCTCTCTTT
CYP2C19
*6   R132Q   36 10 96525200 CAATGGAAAGAGATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGC GAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAG
CYP2C19
*7 (19294T>A)     36 10 96531746 CAACAACCCTCGGGACTTTATTGATTGCTTCCTGATCAAAATGGAGAAGG AAAATGTTAACAAAAGCTTAGTTATGTGACTGCTTGCGTATTTGTGATTC
CYP2C8
*3   K399R rs10509681 36 10 96788739 TCTTATCTAGAAAGTGGCCAGGGTCAAAGATATTTGGATTAGGAAATTCT TGTCATCATGTAGCACGGAAGTCAGTAATGCCATTATGGTTGTGCCCTGG
CYP2C8
*4   I264M rs1058930 36 10 96808109 CTGATCTGTTGCTAATATCTTACCTGCTCCATTTTGATCAGGAAGCAATC ATAAAGTCCCGAGGATTGTTAACATCCAGTGATGCTTGGTGTTCTTTTAC
CYP2C8
*3   R139K rs11572080 36 10 96817020 ACTCCTCCACAAGGCAGTGAGCTTCCTCTTGAACACGGTCCTCAATGCTC TCTTCCCCATCCCAAAATTCCGCAAGGTTGTGAGGGAGAAACGCCGGATC
CYP2C8
*2   I269F rs11572103 36 10 96808096 AGAAATCAAAATACTGATCTGTTGCTAATATCTTACCTGCTCCATTTTGA CAGGAAGCAATCGATAAAGTCCCGAGGATTGTTAACATCCAGTGATGCTT
CYP2C8
*5 2189delA     36 10 96816965 GTAACTGTTAAGGTCAATGACGCAGAGTAGAGTCACCCACCCTTGGTTTT CTCAACTCCTCCACAAGGCAGTGAGCTTCCTCTTGAACACGGTCCTCAAT
CYP2C8
*7       36 10 96814633 ATTGAATCTTTTCATCAGGGTGAGAAAATTCTGATCTTTATAATCAAATC TTTCTGGAAAACAACGGAGCAGATCACATTGCAGGGAGCACAGCCCAGGA
CYP2C8
*8       36 10 96814633 ATTGAATCTTTTCATCAGGGTGAGAAAATTCTGATCTTTATAATCAAATC TTTCTGGAAAACAACGGAGCAGATCACATTGCAGGGAGCACAGCCCAGGA
CYP2C9
*3     rs1057910 36 10 96731043 GGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATAC TTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAA
CYP2C9
*9     rs2256871 36 10 96698964 TAAAAACGTTGCTTTTATGAAAAGTTATATTTTGGAAAAAGTAAAAGAAC CCAAGAATCAATGGACATGAACAACCCTCAGGACTTTATTGATTGCTTCC
CYP2C9
*11     rs28371685 36 10 96730971 TCTTATCAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAAC GGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTG
CYP2C9
*5 42619C>G   rs28371686 36 10 96731048 CACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATTGA CTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAG
CYP2C9
*8     rs7900194 36 10 96692056 TTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCC CTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGGTGGGTGACCCTACTCCA
CYP2C9
*10     rs9332130 36 10 96699027 GGACATGAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGG GAAGGTAAAATGTAAACAAAAGCTTAGTTATGTGACTGCTTGTGAATTTG
CYP2C9
*12 50338C>T   rs9332239 36 10 96738767 TTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATT CTGTCTGAAGAAGAGCAGATGGCCTGGCTGCTGCTGTGCAGTCCCTGCAG
CYP2C9
*2     rs1799853 36 10 96692037 CCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGAC GTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAG
CYP2C9
*4 42615T>C   rs56165452 36 10 96731044 GAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACA TGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAAT
CYP2C9
*13 3276t>c     36 10 96691705 CATAGTGGTGCTGCATGGATATGAAGCAGTGAAGGAAGCCCTGATTGATC TGGAGAGGAGTTTTCTGGAAGAGGCATTTTCCCACTGGCTGAAAGAGCTA
CYP2C9
*15 9100c>a     36 10 96697529 TTATATCTAAAGTTTAATAGTATTTTAAATTGTTTCTAATTATTTAGCCT ACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCT
CYP2C9
*25 3531_3540delAGAAATGGAA)     36 10   TCGTTTCTCTTCCTGTTAGGAATTGTTTTCAGCAATGGAA GGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGAT
CYP2C9
*6     rs9332131 36 10 96699029   ACATGAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGGAG
CYP2D6
*10 100C>T   rs1065852 36 22 40856638 GTCCACATGCAGCAGGTTGCCCAGCCCGGGCAGTGGCAGGGGGCCTGGTG GTAGCGTGCAGCCCAGCGTTGGCGCCGGTGCATCAGGTCCACCAGGAGCA
CYP2D6
*2a     rs1080985 36 22 40858326 ATGAGCCACCGCACCCAATCCCAGCTAATTTTGTATTTTTTGTAGAGACC GGTTCTTCCAAGTTGTCCAGGCTGGTCTTGAATTCCTGGGGTGAAGCGAT
CYP2D6
*2   S486T rs1135840 36 22 40852557 TAGGTACCCCATTCTAGCGGGGCACAGCACAAAGCTCATAGGGGGATGGG TCACCAGGAAAGCAAAGACACCATGGTGGCTGGGCCGGGGCTGTCCAGTG
CYP2D6
*17 1023C>T   rs28371706 36 22 40855716 GTCCCCACCGCTGCTTGCCTTGGGAACGCGGCCCGAAACCCAGGATCTGG TGATGGGCACAGGCGGGCGGTCGGCGGTGTCCTCGCCGTGGGTCACCAGC
CYP2D6
*41 2988G>A   rs28371725 36 22 40853749 TGGAGCCCCGGGTGTCCCAGCAAAGTTCATGGGCCCCCGCCTGTACCCTT CTCCCTCGGCCCCTGCACTGTTTCCCAGATGGGCTCACGCTGCACATCCG
CYP2D6
*4 1846G>A   rs3892097 36 22 40854891 CACGTTGCTCACGGCTTTGTCCAAGAGACCGTTGGGGCGAAAGGGGCGTC TGGGGGTGGGAGATGCGGGTAAGGGGTCGCCTTCCCCGTCCCCCGCCTTC
CYP2D6
*7 2935A>C   rs5030867 36 22 40853802 CCCTCGGCCCCTGCACTGTTTCCCAGATGGGCTCACGCTGCACATCCGGA GTAGGATCATGAGCAGGAGGCCCCAGGCCAGCGTGGTCGAGGTGGTCACC
CYP2D6
*12 124G>A;   rs5030862 36 22 40856614 GAAGCAGTATGGTGTGTTCTGGAAGTCCACATGCAGCAGGTTGCCCAGCC GGGCAGTGGCAGGGGGCCTGGTGGGTAGCGTGCAGCCCAGCGTTGGCGCC
CYP2D6
*3 2549A>del   rs35742686 36 22 40854188 GAAGGCCTCAGTCAGGTCTCGGGGGGGCTGGGCTGGGTCCCAGGTCATCC GTGCTCAGTTAGCAGCTCATCCAGCTGGGTCAGGAAAGCCTTTTGGAAGC
CYP2D6
*14 1758G>A;   2D6*14 36 22 40854979 GTCCCCCGCCTTCCCAGTTCCCGCTTTGTGCCCTTCTGCCCATCACCCAC GGAGTGGTTGGCGAAGGCGGCACAAAGGCAGGCGGCCTCCTCGGTCACCC
CYP2D6
*11 883G>C   rs5030863 36 22 40855856 GGCGTCCAGGCCAGCTGCAGGCTGAACACGTCCCCGAAGCGGCGCCGCAA TGCAGAGGGAGGGTCAGGGCCTCTTGTCAAGCCAGGATCCCCCCAGACTA
CYP2D6
*8 1758G>T   rs5030865 36 22 40854979 GTCCCCCGCCTTCCCAGTTCCCGCTTTGTGCCCTTCTGCCCATCACCCAC GGAGTGGTTGGCGAAGGCGGCACAAAGGCAGGCGGCCTCCTCGGTCACCC
CYP2D6
*9 2613-2615delAGA   rs5030656 36 22 40848676 - 40848678 TGAGGCCTTCCTGGCAGAGATGGAG GTGAGAGTGGCTGCCACGGTGGGGG
CYP2D6
*15  137-138insT (frameshift)     36 22   caccaggccccctgccactgcccgggctgggcaaccT Gctgcatgtggacttccagaacacaccatact
CYP2D6
*18 4125_4133dupGTGCCCACT     36 22   tcctcttcttcacctccctgctgcagcacttcagcttctcgGTGCCCACT ggacagccccggcccagCCACCATGGT
CYP2D6
*19 2539_2542delAACT     36 22   ttccaaaaggctttcctgacccagctggatgagctgct gagcacaggatgacctgggacccagcccagcccccccgagacctgactga
CYP2D6
*20 1973_1974insG     36 22   AGGCTGCTGGACCTAGCTCAGGa gGGACTGAAGGAGGAGTCGGGCTTTCT
CYP2D6
*21 2573_2574insC     36 22 2573_2574insC GATGACCTGGGACCCAGCCCAGC CCCCCCGAGACCTGACTGAGGCCTTCC
CYP2D6
*38 2587_2590delGACT     36 22 2587_2590delGACT GATGACCTGGGACCCAGCCCAGCCCCCCCGAGACCT GAGGCCTTCCTGGCAGAGATGGAGAAGGTGAGAGTGGCTGCCACGGTGGG
CYP2D6
*40 1863_1864ins(TTT CGC CCC)2     36 22   AGGCGACCCCTTACCCGCATCTCCCACCCCCAGGACGCCCCTTTCGCCCc aACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCG
CYP2D6
*42 3259_3260insGT     36 22 3259_3260insGT CACCACTGCCGTGATTCATGAGGT GCAGCGCTTTGGGGACATCGTCCCCCTGGGTGTGACCCATATGACATCCC
CYP2D6
*44 2950G>C     36 22 40853787 GCCTGTACCCTTCCTCCCTCGGCCCCTGCACTGTTTCCCAGATGGGCTCA GCTGCACATCCGGATGTAGGATCATGAGCAGGAGGCCCCAGGCCAGCGTG
CYP2D6
*56 3201C>T     36 22   GACGACGTGATAGGGCAGGTGCGG GACCAGAGATGGGTGACCAGGCTCA
CYP2D6
*6 1707T>del   rs5030655 36 22 40855030   GGAGTGGTTGGCGAAGGCGGCACAAAGGCAGGCGGCCTCCTCGGTCACCC
CYP2D6
*5 gene deletion     36 22 gene deletion    
CYP2E1
*2   R76H   36 10 135192024 GTTGGCCCAGCGCTTCGGGCCGGTGTTCACGCTGTACGTGGGCTCGCAGC CATGGTGGTGATGCACGGCTACAAGGCGGTGAAGGAAGCGCTGCTGGACT
CYP3A4
*2 15713T>C   rs55785340 36 7 99203919 TTTAAGAGAGCAAGATAAATAAAAGGAAATAGTAGTCCACATACTTATTG GAGAAAGAATGGATCCAAAAAATCAAATCTTAAAAGCTTCTTGGTGTTTT
CYP3A4
*20 25889_25890insA     36 7 25889_25890insA GGACTTCTTCAACCAGAAAAA CCCGTTGTTCTAAAGGTTGA
CYP3A4
*6     rs4646438 36 7 99201970   GAAACACTCTGGTTACCTTTGTGGGACTCAGTTTCTTTTGAATTCTGAGA
CYP3A5
*6 14690G>A   rs10264272 36 7 99100771 ATACTTATTGAGAGAAATAATGGATCTAAGAAACCAAATTTTAGGAACTT TTAGTGCTCTCCACAAAGGGGTCTTGTGGATTGTTGAGAGAGTCGATGTT
CYP3A5
*10 29753T>C   rs41279854 36 7 99085708 AGAAGTTCTGAAGGACTCTGATTAGAGCAAGTTTCATGTTCATGAGAGCA ACCTCATGCCAATGCAGTTTCTGGGTCCAGTTCCAAAGGGTGTGTATATG
CYP3A5
*3 6986A>G   rs776746 36 7 99108475 CCAAGGCTTCATATGATGAAGGGTAATGTGGTCCAAACAGGGAAGAGATA TGAAAGACAAAAGAGCTCTTTAAAGAGATTATGGTTAGAAATGACAGTAG
CYP3A5
*5     rs55965422 36 7 99102509 TCCCCAGATTCATTCTTTACATTTCTAATTAAGACTCATCTTATTTTCAT CCTCCTTGAGTTTTCCGCTGGTGAAGGTTGGAGACAGCAATGACCGTATT
CYP3A5
*7     rs41303343 36 7 99088358 TTCTGTTTCTTTCCTTCCAGGCACCACCT ACCTATGATGCCGTGGTACAGATGGAGTACCTTGACATGGT
DPYD
*7  295delTCAT     36 1   AGATGCCCCGTGTCAGAAGAGCTGTCCAACTAATCTTGATATTAAA TCATCACAAGTATTGCAAACAAGGTAAATTCAGATTTAA
DPYD
*9A   C29R rs1801265 36 1 98121473 AGGATTTCTTTTCCAATGTTTCTTGTCTAATTTCTTGGCCGAAGTGGAAC CAGAGTTGCATGAGTTTGTGTTCGAGGATTTAAAGCCAGGATACTCTAAA
DPYD
*8   R235W rs1801266 36 1 97929920 AAGGTCCTTCATTAGCTCAATCTCAAAATTCACTACATCATACGGCAGCC GAACTGAGGAATTTCAGAAGTACTGAAAAGAAAGGAGAAAGAAAAACAGG
DPYD
*9B 2657G>A  R886H RS1801267 36 1 97336742 CTACATTTTGTTCTTTCAGTCTAATCTTGTTTTCTGCTATGATTTTCTTG GCTGTTCCAGATAAGGTCCAAAACTTGGCAGTTTCTAAAAGGAAAACACA
DPYD
*10 2983G>T V995F RS1801268 36 1 97317215 ATAAGGTGTTGTCCTGGAAACCATTTTGATGCAGTCGACAATAGGGCAAA ACTGAGACACAGAGTACAGCCTGTACAAGTGTCGGTTATGGTGGGCAGGT
GSTM1
*B    K172N rs1065411 36 1      
GSTM1
*X2       36 1 duplication    
GSTM1
Null gene deletion     36 1 gene deletion    
GSTP1
*A_*B_*C_*D   V114A rs1138272 36 11 67110155 GGCTGGGAGGGATGAGAGTAGGATGATACATGGTGGTGTCTGGCAGGAGG GGGCAAGGATGACTATGTGAAGGCACTGCCCGGGCAACTGAAGCCTTTTG
GSTP1
*A_*B_*C_*D   V105I rs1695 36 11 67109265 CCCTGGTGGACATGGTGAATGACGGCGTGGAGGACCTCCGCTGCAAATAC TCTCCCTCATCTACACCAACTATGTGAGCATCTGCACCAGGGTTGGGCAC
GSTT1
Null gene deletion     36 22 gene deletion    
NAT1
*14 560G>A R187Q rs4986782 36 8 18124396 TCCAAATGAAGAATTTCTTCATTCTGATCTCCTAGAAGACAGCAAATACC AAAAATCTACTCCTTTACTCTTAAGCCTCGAACAATTGAAGATTTTGAGT
NAT1
*11  640T>G S214A rs4986783 36 8 18124476 A ATTGAAGATT TTGAGTCTAT GAATACATACCTGCAGACAT CTCCA CATCTGTGTT TACTAGTAAA TCATTTTGTT CCTTGCAGAC CCCAGA
NAT1
*15  559C>T R187X rs5030839 36 8 18124395 ATG AAGAATTTCT TCATTCTGAT
 CTCCTAGAAG ACAGCAAATA C
RAAAAATCTA CTCCTTTACT CTTAAGCCTC GAACAATTGA AGATTT
NAT1
*19  97C>T R33X rs56318881 36 8 18123933 GGAACAAATTGGACTTGGAAACATTAACTGACATTCTTCAACACCAGATC GAGCTGTTCCCTTTGAGAACCTTAACATCCATTGTGGGGATGCCATGGAC
NAT1
*17  190C>T R64W rs56379106 36 8 18124026 CCATGGACTTAGGCTTAGAGGCCATTTTTGATCAAGTTGTGAGAAGAAAT GGGGTGGATGGTGTCTCCAGGTCAATCATCTTCTGTACTGGGCTCTGACC
NAT1
*22 752A>T D251V rs56172717 36 8 18124588 AGATTCAATTATAAGGACAATACAG TCTAATAGAGTTCAAGACTCTGAGT
NAT1
*5     rs55793712 36 8 18124720 GCTTGTGCCCAAACATGGTGATAGATTTTTTACTATTTAGAATAAGGAGT AAACAATCTTGTCTATTTGTCATCCAGCTCACCAGTTATCAACTGACGAC
NAT2
*13 282C>T   rs1041983 36 8 18302075 GCTCTGACCACAATCGGTTTTCAGACCACAATGTTAGGAGGGTATTTTTA ATCCCTCCAGTTAACAAATACAGCACTGGCATGGTTCACCTTCTCCTGCA
NAT2
*12 803A>G   rs1208 36 8 18302596 TCTGGTCGAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGA AAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTG
NAT2
*11 481C>T   rs1799929 36 8 18302274 CTCAGGTGCCTTGCATTTTCTGCTTGACAGAAGAGAGAGGAATCTGGTAC TGGACCAAATCAGGAGAGAGCAGTATATTACAAACAAAGAATTTCTTAAT
NAT2
*6     rs1799930 36 8 18302383 CCTGCCAAAGAAGAAACACCAAAAAATATACTTATTTACGCTTGAACCTC AACAATTGAAGATTTTGAGTCTATGAATACATACCTGCAGACGTCTCCAA
NAT2
*7     rs1799931 36 8 18302650 TATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATG ATCCCTTACTATTTAGAATAAGGAACAAAATAAACCCTTGTGTATGTATC
NAT2
*14  191G>A R64Q rs1801279 36 8 18301984 GAGTT GGGCTTAGAG GCTATTTTTG ATCACATTGT AAGAAGAAACY  GGGTGGGTGG TGTCTCCAGG TCAATCAACT TCTGTACTGG GCTCT
NAT2
*5 341T>C   rs1801280 36 8 18302134 AGTTAACAAATACAGCACTGGCATGGTTCACCTTCTCCTGCAGGTGACCA TGACGGCAGGAATTACATTGTCGATGCTGGGTCTGGAAGCTCCTCCCAGA
NAT2
*19  190C>T R64W rs1805158 36 8 18301983 GAGTT GGGCTTAGAG GCTATTTTTG ATCACATTGT AAGAAGAAAC   RGGGTGGGTG GTGTCTCCAG GTCAATCAAC TTCTGTACTG GGCTC
SLC15A2
    P409S rs1143671 36 3 123129976 TGGTGATTCTGACATGTGTTCTTTGCTCTAAGGAAATGGCCCCAGCCCAG CAGGTCCCCAGGAGGTTTTCCTACAAGTCTTGAATCTGGCAGATGATGAG
SLC15A2
    R509K rs1143672 36 3 123130858 TGTTACTGATTTTTACTTTCCTCTGTTGTAGGTAAAGGATACAGAAAGCA AACAACCAATGGGATGACAACCGTGAGGTTTGAATGTCAATGAGATTCCA
SLC15A2
    L350F rs2257212 36 3 123126494 AATATTTGTAGCTAATCCTTTTTATCATGGTGTTACAGGTTCTAAATCCC TTCTGGTTCTTATCTTCATCCCGTTGTTTGACTTTGTCATTTATCGTCTG
SLC15A2
    A284A rs2293616 36 3 123124383 AAGAACCGTTCTGGAGACATTCCAAAGCGACAGCACTGGCTAGACTGGGC GCTGAGAAATATCCAGTAAGTTGGAAATGCAGAAACATCTTATGGCTTGA
SLC22A1
    R61C rs12208357 36 6 160463138 TCACACCTGACCACCACTGCCAGAGTCCTGGGGTGGCTGAGCTGAGCCAG GCTGTGGCTGGAGCCCTGCGGAGGAGCTGAACTATACAGTGCCAGGCCTG
SLC22A1
    P341L rs2282143 36 6 160477633 GGATGTCACCGAAAAGCTGAGCCCTTCATTTGCAGACCTGTTCCGCACGC GCGCCTGAGGAAGCGCACCTTCATCCTGATGTACCTGTGGTGAGGGGCGT
SLC22A1
    P283L rs4646277 36 6 160477250 AGACCGAGGAAAATGCCAGATAGTGATGAGTGGTGTTCGCAGGTGTGTGC GGAGTCCCCTCGGTGGCTGTTATCACAAAAAAGAAACACTGAAGCAATAA
SLC22A1
    R287G rs4646278 36 6 160477261 AATGCCAGATAGTGATGAGTGGTGTTCGCAGGTGTGTGCCGGAGTCCCCT GGTGGCTGTTATCACAAAAAAGAAACACTGAAGCAATAAAGATAATGGAC
SLC22A1
    M408V rs628031 36 6 160480835 TCATAGCCCTCATCACCATTGACCGCGTGGGCCGCATCTACCCCATGGCC TGTCAAATTTGTTGGCGGGGGCAGCCTGCCTCGTCATGATTTTTATCTCA
SLC22A1
    G220V rs36103319 36 6 160473397 GCTCTTCCGCCTGCTGCAGGGCCTGGTCAGCAAGGGCAACTGGATGGCTG CTACACCCTAAGTAATTATCATGGGGATGAGGCCAGGTCTCAGGGTAGAA
SLC22A1
    C88R rs55918055 36 6 160463219 ACTATACAGTGCCAGGCCTGGGGCCCGCGGGCGAGGCCTTCCTTGGCCAG GCAGGCGCTATGAAGTGGACTGGAACCAGAGCGCCCTCAGCTGTGTAGAC
SLC22A1
    G401S rs34130495 36 6 160480814 TGGTCGAAATCCCGGGGGCCTTCATAGCCCTCATCACCATTGACCGCGTG GCCGCATCTACCCCATGGCCATGTCAAATTTGTTGGCGGGGGCAGCCTGC
SLC22A1
    G465R rs34059508 36 6 160495827 AATCACAGAATTATCGTATTTTTTGTCCTTTGTATTTTATCAGGAACCTC GAGTGATGGTGTGTTCCTCCCTGTGTGACATAGGTGGGATAATCACCCCC
SLC22A1
    M420del   36 6 160480871-160480874 AATTTGTTGGCGGGGGCAGCCTGCCTCGTC ATTTTTATCTCACCTGGTAAGTTGGT
SLC22A2
*4   S270A rs316019 36 6 160590272 TTCCAAATGGACTTACCAGTAATAGAGCAAGAAGAAGAAGTTGGGCAGAG AACTGTGAACTGCAACCACCTCCAGTGAGGAAGTGCGTAAGCCACCCCAG
SLC22A2
*7   R400C rs8177516 36 6 160584675 TGCCCCTGCAACCATATTTGATGCAGCCCAAGGGTAACGGCGTCCGATGC GTCGATGGTGAGGATGATCATGAAGGCAGCTGGGAATTCAACCAGGGCAG
SLC22A2
    K432Q rs8177517 36 6 160583410 CTCATAGGCCATTGTGATCCCCATTCTTCCCAAGCATGAGATAATAATTT TAGCCATTGTAGATCTAAGAGGGAAAAGAACAGTACTTATCCGTACACAG
SLC22A2
    M165I rs8177507 36 6 160597659 TTGGACCTATTCCAGTCATCAGTGAATGTAGGATTCTTTATTGGCTCTAT AGTATCGGCTACATAGCAGACAGGTAGGTTGAATCACCTGTGGTGGAATT
SLC22A2
    P54S rs8177504 36 6 160599620 ACGTGGGCATCGTCTTCCTGGGCTTCACCCCTGACCACCGCTGCCGGAGC CCGGAGTGGCCGAGCTGAGTCTGCGCTGCGGCTGGAGTCCTGCAGAGGAA
SLC22A6
    R50H rs11568626 36 11 62508590 GCCAGACCTCCAGCCCCCCGTTCTTGCTGAGGTTGGCATCGGCAGGCGGG GGCAGTGGTGGGTAGGGATGGCAGCAGTGAAGTTCTGCAGGGTGTTGTGA
SLCO1B1
*1B   N130D RS2306283 36 12 21221005 TAATTCAGTGATGTTCTTACAGTTACAGGTATTCTAAAGAAACTAATATC ATTCATCAGAAAATTCAACATCGACCTTATCCACTTGTTTAATTAATCAA
SLCO1B1
*5   V174A RS4149056 36 12 21222816 TATCTACATAGGTTGTTTAAAGGAATCTGGGTCATACATGTGGATATATG GTTCATGGGTAATATGCTTCGTGGAATAGGGGAGACTCCCATAGTACCAT
SLCO1B1
*2   F73L rs56101265 36 12 21216983 AACGGAGATTTGAGATATCCTCTTCTCTTGTTGGTTTTATTGACGGAAGC TTGAAATTGGTAACATTTATTTTCTATTTTAATAACCAAACTTGCAAAGT
SLCO1B1
*3   V82A rs56061388 36 12 21218796 GCTGTATCAACATAATTTTGTTCCCTTTCTAGGAAATTTGCTTGTGATTG ATTTGTGAGTTACTTTGGATCCAAACTACATAGACCAAAGTTAATTGGAA
SLCO1B1
*6   I353T rs55901008 36 12 21244796 CCTGTATGTTATGTTTGTGCTTTTGACGTTGTTACAAGTAAGCAGCTATA TGGTGCTTTTACTTATGTCTTCAAATACGTAGAGCAACAGTATGGTCAGC
SLCO1B1
*9   G488A rs59502379 36 12 21250200 ACCAGTCTGTGGAAACAATGGAATAACTTACATCTCACCCTGTCTAGCAG TTGCAAATCTTCAAGTGGCAATAAAAAGCCTATAGTGAGTATTAGTTTTT
SLCO1B1
*10   D655G rs56199088 36 12 21283278 TTTATATATTATATTAATTTATGCCATGAAGAAAAAATATCAAGAGAAAG TATCAATGCATCAGAAAATGGAAGTGTCATGGATGAAGCAAACTTAGAAT
SLCO1B1
*11   E667G rs55737008 36 12 21283314 ATATCAAGAGAAAGATATCAATGCATCAGAAAATGGAAGTGTCATGGATG AGCAAACTTAGAATCCTTAAATAAAAATAAACATTTTGTCCCTTCTGCTG
SLCO1B1
*12 Haplotype of *10 and *2              
SLCO1B1
*3   E156G   36 12 21221084 ATCCACTTGTTTAATTAATCAAATTTTATCACTCAATAGAGCATCACCTG GATAGTGGGAAAAGGTAAGAATTAATATTGACAGTAAAAAGTCTTCTAAA
SLCO1B3
  334T>G  A112S rs4149117 36 12 20902747 AGTTAATTGGAATTGGTTGTCTCCTTATGGGAACTGGAAGTATTTTGACA CTTTACCACATTTCTTCATGGGATAGTAAGTGTTAAACAGCTCTGAGCCA
SLCO1B3
  699G>A I233M rs7311358 36 12 20907027 ATGATTGGTCCAGTCATTGGCTTTGCACTGGGATCTCTGTTTGCTAAAAT TACGTGGATATTGGATATGTAGATCTGAGTAAGTACAATTAGAACAAGGT
SLCO2B1
*3   S486F rs2306168  36 12 74585230 AACCCTACTGGTCTTCTCTCCCACCAGTGCCCACCCTGGGCTGGAGCTGT TCCAAGCTGCATGGAGGCCTGCTCCTGCCCATTGGACGGCTTTAACCCTG
SULT1A1
*2   H213R rs9282861 36 16 28525015 TGAACGACGTGTGCTGAACCACGAAGTCCACGGTCTCCTCTGGCAGGGAG GCCCCACAAACTCCAGGATCTTTTGAATCTCCCTTTTCGGGTTCTGAGCA
SULT1A1
*3   M223V rs1801030 36 16 28524986 GTTGGTCATAGGGTTCTTCTTCATCTCCTTGAACGACGTGTGCTGAACCA GAAGTCCACGGTCTCCTCTGGCAGGGAGCGCCCCACAAACTCCAGGATCT
SULT1A1
*4   R37Q   36 16 28527568 CTCCTCACTTACCGGACTTGGGGTAGGTGCTGATGAGCAGGTCATCAGGC GGGCCTGGAAGCTCTGCAGGGGCCCCAGTGCCTCTGCAAAGTACTTGATG
SULT1A1
Null gene deletion     36 16 deletion    
SULT1A1
XN       36 16 duplication    
TPMT
*3c 719A>G C240Y rs1142345 36 6 18238897 TCAGTGTGATTTTATTTTATCTATGTCTCATTTACTTTTCTGTAAGTAGA ATAACTTTTCAAAAAGACAGTCAATTCCCCAACTTTTATGTCGTTCTTCA
TPMT
*3b 460 G>A A154T rs1800460 36 6 18247207 AAGAAAAATTACTTACCATTTGCGATCACCTGGATTGATGGCAACTAATG TCCTCTATCCCAAATCATGTCAAATTTGCCAATATTTGTCCTACCAGAAA
TPMT
*2    A80P rs1800462 36 6 18251934 TATCCCAAGTTCACTGATTTCCACACCAACTACACTGTGTCCCCGGTCTG AAACCTGCATAAAATCATACATTTACACTTAAATTATGTTTTCAAATGAC
TPMT
*8   R225H rs56161402 36 6 18238972 TTCCCCAACTTTTATGTCGTTCTTCAAAAGCATCAACCTTCTCAAGACAA GTATATTGCATATTTTACCTGAAACAAGAAAGAGTAACATGTTAAAATAC
TPMT
*4     rs1800584 36 6 18238991 TTCTTCAAAAGCATCAACCTTCTCAAGACAACGTATATTGCATATTTTAC TGAAACAAGAAAGAGTAACATGTTAAAATACTATGAAGAATGACATCAGG
TPMT
*3a Haplotype of *3b+*3c              
UGT1A1
*60     rs4124874 36 2 234330398 TAAGCACGCAATGAACAGTCATAGTAAGCTGGCCAAGGGTAGAGTTCAGT TGAACAAAGCAATTTGAGAACATCAAAGGAAGTTTGGGGAACAGCAAGGG
UGT1A1
*6     rs4148323 36 2 234333883 GACATGAAATAGTTGTCCTAGCACCTGACGCCTCGTTGTACATCAGAGAC GAGCATTTTACACCTTGAAGACGTACCCTGTGCCATTCCAAAGGGAGGAT
UGT1A1
*7     rs34993780 36 2 234345798 AGGGCGCGCCACACCTGCGCCCCGCAGCCCACGACCTCACCTGGTACCAG ACCATTCCTTGGACGTGATTGGTTTCCTCTTGGCCGTCGTGCTGACAGTG
UGT1A1
*29   R367G rs55750087 36 2 234341619 TGTAACTGCTGACATCCTCCCTATTTTGCATCTCAGGTCACCCGATGACC GTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGC
UGT1A1
*27     rs35350960 36 2 234334358 CATGCTCATTGCCTTTTCACAGAACTTTCTGTGCGACGTGGTTTATTCCC GTATGCAACCCTTGCCTCAGAATTCCTTCAGAGAGAGGTGACTGTCCAGG
UGT1A1
*28 _ *36 _*37 (TA)6_(TA)7_(TA)5_(TA)8   rs8175347 36 2 234333619 TCACGTGACACAGTCAAACATTAACTTGGTGTATCGATTGGTTTTTGCCA TAAGTAGGAGAGGGCAACCTCTGGCAGGAGCAAAGGCGCCATGGCTGTGG
UGT2B15
*2   D85Y rs1902023 36 4 69570689 AACACCATATATCCATCTATCGAGAATTTTCAGAAGAGAATCTTCCAAAT ATTTTTAGTTAAAGATGTAGGATAAACTTCTAATTTAATAGCAGATGATT
UGT2B17
*2 Deletion of a 150kb region spanning the UGT2B17 gene     36 4 deletion    
UGT2B7
*2    H268Y rs7439366 36 4 69998927 GGAAAGCTGACGTATGGCTTATTCGAAACTCCTGGAATTTTCAGTTTCCA ATCCACTCTTACCAAATGTTGATTTTGTTGGAGGACTCCACTGCAAACC

 

 

 

© 2017 www.pharmaadme.org
Joomla! is Free Software released under the GNU/GPL License.

Get The Best Free Joomla Templates at www.joomla-templates.com