Wednesday, 24 February 2021
  Home arrow Core Markers
template designed by
Main Menu
ADME Gene List
Related Gene List
Core Markers
Contact Us
Core Marker List Print E-mail

This is a list of the markers that we determined to be most important. Note that not all of these markers have been reported previously in dbSNP.


Core Marker List

Star Nomenclature Nucloetide Change Amino Acid Change RS # Build Chromosome Position Upstream Sequence Downstream Sequence
*20 2141_2142delAA   rs28399444 36 19 46046280 ctttggggaccgctttgactataaggaca gagttcctgTCACTGTTGC
*12   exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin   36 19      
*1X2a   Breakpoint at intron 8 - 3'-UTR   36 19      
*1X2b   Breakpoint at 5.2 - 5.6 kb downstream from stop codon   36 19      
*4 gene deletion     36 19      
*17 -806C>T   rs12248560          
*9 2613-2615delAGA   rs5030656 36 22 40848676 - 40848678 TGAGGCCTTCCTGGCAGAGATGGAG GTGAGAGTGGCTGCCACGGTGGGGG
*15  137-138insT (frameshift)     36 22   caccaggccccctgccactgcccgggctgggcaaccT Gctgcatgtggacttccagaacacaccatact
*18 4125_4133dupGTGCCCACT     36 22   tcctcttcttcacctccctgctgcagcacttcagcttctcgGTGCCCACT ggacagccccggcccagCCACCATGGT
*19 2539_2542delAACT     36 22   ttccaaaaggctttcctgacccagctggatgagctgct gagcacaggatgacctgggacccagcccagcccccccgagacctgactga
*5 gene deletion     36 22 gene deletion    
*20 25889_25890insA     36 7 25889_25890insA GGACTTCTTCAACCAGAAAAA CCCGTTGTTCTAAAGGTTGA
*B    K172N rs1065411 36 1      
*X2       36 1 duplication    
Null gene deletion     36 1 gene deletion    
Null gene deletion     36 22 gene deletion    
*15  559C>T R187X rs5030839 36 8 18124395 ATG AAGAATTTCT TCATTCTGAT
*12 Haplotype of *10 and *2              
Null gene deletion     36 16 deletion    
XN       36 16 duplication    
*3a Haplotype of *3b+*3c              
*2 Deletion of a 150kb region spanning the UGT2B17 gene     36 4 deletion    




© 2021
Joomla! is Free Software released under the GNU/GPL License.

Get The Best Free Joomla Templates at